86
|
Jackson Laboratory
n a mouse N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/n a mouse/product/Jackson Laboratory Average 86 stars, based on 1 article reviews
n a mouse - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
sangon biotech n a p5 atac Sangon Biotech N A P5 Atac, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sangon biotech n a p5 atac/product/Sangon Biotech Average 86 stars, based on 1 article reviews
sangon biotech n a p5 atac - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Jackson Laboratory
paper n a mouse Paper N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/paper n a mouse/product/Jackson Laboratory Average 86 stars, based on 1 article reviews
paper n a mouse - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Jackson Laboratory
n a N A, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/n a/product/Jackson Laboratory Average 86 stars, based on 1 article reviews
n a - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
sangon biotech n a primer Sangon Biotech N A Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sangon biotech n a primer/product/Sangon Biotech Average 86 stars, based on 1 article reviews
sangon biotech n a primer - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Jackson Laboratory
utrecht n a mouse Utrecht N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/utrecht n a mouse/product/Jackson Laboratory Average 86 stars, based on 1 article reviews
utrecht n a mouse - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
nnnnnnnnncggcatggacgagctg sangon biotech n a linker sadbc f Nnnnnnnnncggcatggacgagctg Sangon Biotech N A Linker Sadbc F, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nnnnnnnnncggcatggacgagctg sangon biotech n a linker sadbc f/product/Sangon Biotech Average 86 stars, based on 1 article reviews
nnnnnnnnncggcatggacgagctg sangon biotech n a linker sadbc f - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Wikimedia Foundation
a n A N, supplied by Wikimedia Foundation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/a n/product/Wikimedia Foundation Average 86 stars, based on 1 article reviews
a n - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
paper n a tn5 primera Paper N A Tn5 Primera, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/paper n a tn5 primera/product/Sangon Biotech Average 86 stars, based on 1 article reviews
paper n a tn5 primera - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Azenta
genewiz n a id3 cdnaseq f Genewiz N A Id3 Cdnaseq F, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/genewiz n a id3 cdnaseq f/product/Azenta Average 86 stars, based on 1 article reviews
genewiz n a id3 cdnaseq f - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Jackson Laboratory
tony wyss coray58 n a human clybl 6 tf img ipsc jackson laboratory cat Tony Wyss Coray58 N A Human Clybl 6 Tf Img Ipsc Jackson Laboratory Cat, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tony wyss coray58 n a human clybl 6 tf img ipsc jackson laboratory cat/product/Jackson Laboratory Average 86 stars, based on 1 article reviews
tony wyss coray58 n a human clybl 6 tf img ipsc jackson laboratory cat - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Merck & Co
ggccttcgtttttgataagtc merck n a primer Ggccttcgtttttgataagtc Merck N A Primer, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ggccttcgtttttgataagtc merck n a primer/product/Merck & Co Average 86 stars, based on 1 article reviews
ggccttcgtttttgataagtc merck n a primer - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |